Journal: Life Science Alliance

Article Title: Multi-omics profiling identifies a deregulated FUS-MAP1B axis in ALS/FTD–associated UBQLN2 mutants

doi: 10.26508/lsa.202101327

Figure Lengend Snippet: (A) Schematic representation of FUS. SYGQ-rich, serine, tyrosine, glycine, glutamine-rich domain; RRM, RNA recognition motif; RGG, arginine-glycine-glycine–rich region; NLS, nuclear localization signal; ZnF, zinc finger domain. (B) Immunoblot analysis of the Phos-tag gel– (upper panel) and SDS–PAGE (lower panel)–separated lysates derived from UBQLN2 WT and amyotrophic lateral sclerosis–mutant LCLs. (C) Immunoblot of UBQLN2 KO HeLa cells treated with two different siRNAs targeting FUS or a nontargeting siRNA control (siCtrl). (C, D) Quantification of MAP1B and FUS protein levels from (C). Data represent mean ± SD. Statistical analysis (n = 3) of the target protein/control protein ratio was performed using one-way ANOVA followed by Dunnett’s post hoc test. (E) SDS–PAGE of recombinant FUS variants (WT, S439A, S439E) stained with Coomassie blue. (F) Electrophoretic mobility shift assay (EMSA) of MBP-FUS-His 6 variants (WT, S439A, S439E) and SON pre-mRNA containing the stem loop and a downstream GUU (5 nM) (n = 3). (G) Immunoblot of FUS WT and KO HeLa cells. (H) FUS WT and KO cells transfected with HA-FUS proteoforms (WT and S439A) or left untreated (MOCK; only Lipofectamine). (I) Quantification of MAP1B protein levels upon expression of HA-FUS WT and S439A from (I). Data represent mean ± SD. Statistical analysis (n = 3) of the target protein/control protein ratio was performed using t test. (J) Working model: in cells with UBQLN2 WT, FUS S439 is constitutively phosphorylated, a state where FUS-RNA binding is impaired. UBQLN2 mutations (P497S and T497I) result in a reduction of pS439 and in elevated MAP1B levels, which are also observed upon UBQLN2 KO. Depending on whether UBQLN2 is functional or defective, KO of FUS has opposing effects on MAP1B levels.

Article Snippet: The stem loop RNA from the SON transcript gene (GGAUCUUUAACUACUCAAGAUACUGAACAUGACAUGGUA) was chemically synthesized with the addition of a Cy5-label (metabion).

Techniques: Western Blot, SDS Page, Derivative Assay, Mutagenesis, Control, Recombinant, Staining, Electrophoretic Mobility Shift Assay, Transfection, Expressing, RNA Binding Assay, Functional Assay

Journal: Oncotarget

Article Title: Cancer therapies activate RIG-I-like receptor pathway through endogenous non-coding RNAs

doi: 10.18632/oncotarget.8420

Figure Lengend Snippet: A. RIG-I binds diverse non-coding RNA molecules, majority of which are snRNAs. Graphic representation indicating the distribution of non-coding and repetitive RNA molecules bound to RIG-I following exposure to IR as compared to total irradiated cellular RNA. Transcripts were mapped to reference genomes using RepeatMasker. See Methods for further details. B. qRT-PCR quantification of U1 RNA from purified RNA bound to ectopically expressing WT and K858A-K861A mutant RIG-I HEK293 cells exposed to IR (6 Gy) or left untreated. Cells were UV crosslinked at 150mJ/cm 2 48 hours post-IR treatment prior to cell lysis. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. C. U1 RNA levels quantified by qRT-PCR from total cellular and RIG-I pulldowns in RIG-I overexpressing HEK293 and HCT116 cells. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. Time course of cytosolic accumulation of U1 RNA measured by qRT-PCR from purified total cellular RNA following cellular fractionation of nuclear/mitochondrial and cytoplasmic fractions of HEK293 D. and HCT116 cells E. exposed to IR (6 Gy) or left untreated. F. The structure of the U1 snRNA illustrating the four stem loop (SL) regions. G. Relative IFN-beta luciferase reporter activity of HEK293 cells following a 24 hour stimulation with synthetic oligonucleotides corresponding to U1 RNA stem loop (SL) regions I to IV or a combination of SL I + II and SL II + III. H. IFN-b levels in culture supernatant from ICR RIG-I +/+ and RIG-I −/− primary MEFs 24 hours post-stimulation with the same set of synthetic U1 oligonucleotides used in G. The amount of U1 synthetic oligonucleotides used in all stimulation experiments was 1μg. P values were determined using unpaired Student's t -test. Error bars are SEM. *** P < 0.005.

Article Snippet: *Synthetic RNA stimulation: Synthethic RNA comprised of various stem loop regions of the human U1 snRNA were purchased from IDT Oligos as reported in [ ].

Techniques: Irradiation, Quantitative RT-PCR, Purification, Expressing, Mutagenesis, Lysis, Cell Fractionation, Luciferase, Activity Assay